De-novo design: settings [Help]

Options for design (can influence ranking)
siRNA length for specificity predicition:  
Exclude regions of low sequence complexity (mDust)
Exclude >5x CA[ACGT] repeats
  • siRNA seed-match analysis (click here for options)
    • Upload FASTA database for mapping siRNA seeds:

      siRNA seed length:   

      Seed-match cutoff:  
  • Prediction of siRNA efficiency (click here for options)
    • Efficiency scoring method:   

      Minimal siRNA efficiency score:  
Maximum overlap with introns allowed (in percent of length of design):   
Allow relaxation of parameters if required (applies to specificity, efficiency, low-complexity and seed-match options)
Design for non-annotated gene models
Options for design evaluation (cannot influence design ranking)
Map designs to the genome
Calculate homology of designs to transcripts using e-value cut-off   
Primer design options
Optimal primer size (bp):
Minimal primer size (bp):
Maximal primer size (bp):
Amplicon size range:
 - 
Maximal primer pair penalty:
Number of primer designs per specific region:
Add promoter sequences for in vitro transcription (or an individual tag)
None
T7: TAATACGACTCACTATAGGG
SP6: ATTTAGGTGACACTATAG
Individual tag:   
Output options
Number of designs reported per query sequence:
GFF file output (for GBrowse database)
AFF file output (for direct GBrowse upload)
Design of independent RNAi reagents
For design of independent RNAi reagents, please upload sequences of primary designs in FASTA format: